“Without a doubt, this is the most important, most wondrous map ever produced by human kind.” […]

Today we are learning the language in which God created life.”

Bill Clinton, 2000 [1]

Die schönste Karte in der Geschichte der Menschheit; die Sprache, in der Gott das Leben erschaffen hat; derart bildhaft und bedeutungsschwanger hat es Bill Clinton damals ausgedrückt. Damals, im Jahr 2000, als die erste vollständige Sequenzierung eines humanen Genoms verlautbart wurde. Aber wird die Sache diesen inhaltsschweren Attributen gerecht? Was ist es denn nun wirklich, was damals bekannt gemacht wurde? Dazu muss zuerst einmal klar werden, worum es sich bei einem Genom handelt.

DER AUFBAU DES GENOMS

Was ist das Genom denn eigentlich? Nun, das Genom bezeichnet die Gesamtheit der Erbinformation, die (großteils) in unseren Zellkernen steckt. Und zwar in JEDEM unserer Zellkerne; denn alle Zellen verfügen über die gesamte Erbinformation, auch wenn sie – je nach ihrer Aufgabe im Körper – nur bestimmte Teile ablesen. Und wie weitestgehend bekannt ist, ist unser Erbgut eben als bestimmte Ausprägung eines besonderen Moleküls gespeichert: der DNA. Doch das Kerngenom besteht aus mehr als nur DNA: vor allem Proteine sind es noch, die zu einem gehörigen Gewichtsanteil zu den Strukturen beitragen, die man dann als Chromatin bzw. als Chromosomen bezeichnet.

Das Ganze muss man sich als unheimlich oft gedrilltes Bändchen vorstellen: auf kleinster Ebene hat man DNA als berühmte Doppelhelix vorliegen. Dabei bilden zwei Stränge, zwei gegenläufige DNA-Moleküle eine gedrehte Leiter in der sich jeweils zwei so genannte Basen gegenüberliegen: Adenin (A) und Thymin (T) können, indem sie zwei Wasserstoffbrücken bilden eine solche Sprossen formen, Guanin (G) und Cytosin (C) können mittels drei Wasserstoffbrücken auch eine solche Sprosse bilden (ein Bild und ein wenig mehr Erklärung dazu gibt es hier). Da immer nur diese Paarungen möglich sind, muss man, wenn man eindeutig eine Sequenz auf der DNA angeben will, immer nur die Basenabfolge von einem Strang angeben, zB. ACGTGCTGACTTTG (der Gegenstrang dazu wäre dann TGCACGACTGAAAC). Diese Doppelhelix ist nun wiederum weiter gedrillt, da sie sich um ganz bestimmte Proteinkomplexe, die Histone, wickelt. Dieser DNA-Histonfaden ist wiederum mehrere Male in sich selber gedrillt um letztlich die weithin bekannten Chromosomen zu bilden, die bereits in den 1870er Jahren nach Beobachtung mit Hilfe einfacher Lichtmikroskope als fädige Strukturen im Zellkern skizziert wurden.


Abbildung 1: Die Erbinformation in unseren Zellkernen. Auf kleinster Ebene ist hier die berühmte Doppelhelix dargestellt in der sich immer zwei Nukleotide gegenüber liegen. Diese Helix ist im Weiteren um Proteinkomplexe, so genannte Histone, gewickelt. Der daraus entstehende Faden ist wiedrum zweifach gedrillt und das Produkt ist dann endlich lichtmikroskopisch zu erkennen und nimmt während der Zellteilung die charakteristische Form eines Chromosoms an.

Obwohl bereits um 1910 gezeigt werden konnte, dass diese merkwürdigen fädigen Gebilde, die Chromosomen, die Träger der Erbinformation sein mussten dauerte es noch eine ganze Zeit bis zum Beispiel die Anzahl der menschlichen Chromosomen korrekt angegeben wurde. Nachdem man jahrelang glaubte, der Mensch habe 48 Chromosomen, konnte ein spanisch-schwedisches Forscherduo im Jahr 1956 zeigen, dass der Mensch wohl nur über 46 Chromosomen verfügt, indem sie die Technik zur Erstellung eines sogenannten Karyogramms maßgeblich verbesserten. Karyogramme dieser Art (in Abbildung 2 ist ein Originalbild aus der Publikation von 1956) werden bis heute gemacht um zum Beispiel eine Veränderung der Chromosomenanzahl oder -form zu erkennen.


Abbildung 2: Die 46 menschlichen Chromosomen. Originalabbildung aus 1956 [2].

DIE KOMBINATION ZWEIER CHROMOSOMEN

Der Mensch hat also in allen seinen Körperzellen 46 Chromosomen, wovon jeweils zwei homolog sind, das heißt, die gleichen Gene tragen (Achtung: nicht unbedingt in der gleichen Ausprägung). Denn eines der beiden homologen Chromosomen haben wir von der Mutter, das andere vom Vater erhalten. Die Ausprägung eines bestimmten Gens ergibt sich nun entweder durch Mischung der mütterlichen und ver väterlichen Variante oder dadurch dass eines der beiden Varianten dominant, die andere rezessiv ist; das heißt die Wirkung des einen überdeckt die des anderen. Doch nicht alle Menschen haben in allen Zellen genau 23 Chromosomenpaare (die im Übrigen praktischerweise einfach der Größe nach durchnummeriert sind). Bereits 1959 wurde entdeckt, dass beispielsweise das bereits 1862 beschriebene Down-Syndrom durch eine veränderte Gesamtanzahl von Chromos0men hervorgerufen wird, nämlich durch das dreifache (statt nur doppelte) Vorkommen des Chromosom 21. Heute kennt man eine ganz Menge an sogenannten strukturellen Chromosomenaberrationen, die bestimmte klinisch und neurologisch relevante Syndrome verursachen können.

Aber nicht nur im ganz Großen gibt es Anomalien , die gesundheitliche Probleme mit sich bringen können, sondern auch im ganz Kleinen. Schon das Fehlen oder der Austausch eines einzelnen Basenpaares kann die Sequenz eines Gens derart durcheinanderbringen, dass kein funktionierendes Protein mehr davon gebaut werden kann. Bei der Mutation ΔF508 in einem Gen, dass aufrgund seiner klinischen Relevanz Cystic Fibrosis Transmembrane Conductance Regulator (CFTR) genannt wird fehlen nur drei Basenpaare (im daraus produzierten Protein fehlt daher genau eine Aminosäure). Diese kleine Veränderung bewirkt allerdings, dass das Protein vom zelleigenen Aufräumsystem abgebaut wird anstatt an der vorgesehenen Stelle seinen Dienst zu erledigen. Die Mutation ΔF508 tritt leider sehr häufig auf, etwa einer von 30 Kaukasiern trägt sie in sich. Treffen zwei dieser Mutationen aufeinander hat das betroffene Kind Cystische Fibrose (auch Mukoviszidose genannt). Durch das Fehlen des CFTR Proteins, einem Ionenkanal, der an der Regulation der Salzkonzentration und daher auch des Flüssigkeitshaushalts an den Schleimhäuten beteiligt ist, leiden diese Patienten unter zähflüssigem Schleim auf allen Schleimhäuten, die dadurch extrem anfällig werden für Infektionen.

ZAHLEN UND FAKTEN (SIND NICHT ALLES)

Neben dem CFTR Gen gibt es noch eine ganz Menge anderer Gene. Laut aktueller Version des menschlichen Genoms nämlich genau 20.363 (ensemble human genome ver38 [2]). Mit dieser Anzahl sind alle so genannten codierenden DNA-Sequenzen gemeint, die innerhalb der Zellen zunächst in RNA, dann in Protein umgeschrieben und übersetzt (transkribiert und translatiert) werden. Diese Zahl hat großes Erstaunen hervorgerufen. Als Biologen in den 1960er Jahre etwa zum ersten Mal über eine konkrete Anzahl der menschlichen Gene nachdachten, schätzten Sie diese in etwa auf 2 Millionen. Als die Totalsequenzierung des menschlichen Genoms um 1990 in Angriff genommen wurde, lagen die populärsten Schätzungen schon nur noch bei 100.000 und zum Zeitpunkt als das humane Genom entschlüsselt war, also zu der Zeit aus der das Eingangszitat stammt, bei etwa 25.000 bis 30.000 zu landen. Seitdem wurde sie nur noch unwesentlich allerdings immer noch stetig nach unten korrigert. Heute gehen wir also von etwas mehr als 20.000 Genen aus, damit hat der Mensch in etwa so viel Gene wie die Maus oder auch der mikroskopisch kleine Fadenwurm C.elegans, der aus nur etwa 1000 Zellen besteht.

Wir haben also lernen müssen, dass höhere Komplexität (wir erachten uns nun mal gerne als komplexere Lebensform als ein Fadenwurm) nicht unbedingt eine höhere Anzahl von Genen erfordert. Aber woran liegt es dann? Nun, man darf nicht vergessen, dass die proteincodierenden Sequenzen weniger als 2% des gesamten Genoms ausmachen und dem Rest, über 98% des Genoms wurde lange Zeit wenig Beachtung geschenkt; ja, es wurde sogar oft als “Junk-DNA” bezeichnet. Heute wissen wir einerseits, dass ein sehr hoher Anteil (vielleicht bis zu 50%) des Genoms sehr wohl in RNA umgeschrieben wird, auch wenn diese RNA dann eben nicht von einem Ribosom abgelesen wird und als Bauplan für ein Protein fungiert. Und im Moment sind wir erst noch im Anfangsstadium, was die Erforschung dieser so genannten nicht-codierenden RNA angeht. Allerdings zeichnet sich bereits jetzt ab, dass RNA, die wir so lange auf ihre Funktions als Informationsüberträger zwischen der DNA des Zellkerns und der Proteinproduktionsmaschinerie im Äußeren der Zelle reduziert hatten, eine nie geglaubte Vielfalt an biologischen Funktionen haben kann. Forschung an dieser nicht-codierenden RNA boomt; berechtigterweise.

GLEICHES GENOM – UNTERSCHIEDLICHE FUNKTION

Zum anderen wusste man allerdings bereits seit Jahrzehnten Bescheid über die regulatorische Funktion vieler Genomabschnitte. Wenn man sich vor Augen hält, dass jede Zelle des menschlichen Körpers in ihrem Zellkern den gesamten genetischen Code trägt, verschiedene Körperzellen allerdings so enorm unterschiedliche Aufgaben erfüllen, dann muss man sich fragen, wie diese Vielfalt erreicht wird. Denn eine beta-Zelle der Bauchspeicheldrüse zum Beispiel produziert hauptsächlich Insulin, das ist ihre Aufgabe, ihr Beitrag zum Erhalt des Organimsus. Die Faserzellen in der Linse des Auges wiederum zeichnen sich durch ihre einzigartige Transparenz aus, eine Eigenschaft, die durch die biochemisch hochentwickelten Kristalline Zustande kommt. Sowohl Insulin als auch Kristalline sind Proteine, d.h. sie werden nach einem Bauplan angefertigt, der in Form einer spezifischen DNA-Sequenz im Genom gespeichert ist. Woher “weiß” also eine Zelle, welche dieser Sequenzen (Gene) sie ablesen soll um entsprechendes Protein zu fertigen und welche nicht? Die Antwort liegt in einem regulatorischen Netzwerk bestehend aus Signalwegen, Transkriptionsfaktoren und den bereits erwähnten regulatorischen Genomabschnitten.

Auf eine Zelle innerhalb (oder auch außerhalb) eines Organismus prasseln ununterbrochen Signale ein. Dabei kann es sich um Atome und Moleküle verschiedenster Klassen handeln. Sehr bekannt sind zum Beispiel Hormone und Neurotransmitter oder auch Nährstoffe und Umweltgifte. Darüber hinaus gibt es noch viel mehr Signalstoffe, die entweder von außerahlb eines Organismus auf dessen Zellen wirken oder aber auch vom Organismus selber dazu eingesetzt werden um die verschiedenartigen Funktionen der Zellen verschiedener Organsysteme zu orchestrieren. Diese Moleküle werden also von unzähligen unterschiedlichen ganz spezifischen Rezeptoren an der Zelloberfläche wahrgenommen, woraufhin die Struktur dieser Rezeptoren verändert wird. Dies wiederum löst innerhalb der Zelle eine Kettenreaktion aus, in der verschiedene zelleigene Stoffe mit der Bildung oder auch der Auflösung von Bindungen zueinander reagieren. Oft führen diese Signalwege dann dazu, dass DNA modifizierende Proteine auf das Genom wirken um dieses chemisch zu verändern. Diese Veränderungen der chemischen Struktur des Genoms führt nun dazu, dass bestimmte Bereich nun sehr zugänglich sind für die Transkriptionsmaschinerie und daher in Folge vermehrt abgelesen werden. Diese eher zugänglichen Bereich des Genoms nennet man Euchromatin. Umgekehrt können aber auch bestimmte Teile des Genoms temporär oder auch dauerhafter inaktiviert werden; sie werden so dicht gepackt und geknäult, dass die ablesenden Proteine nicht mehr an diese Abschnitte binden können. Diese Abschnitte werden Heterochromatin genannt.

Wenn man will, kann man sich das Genom daher als eine Art Buch vorstellen, in der genau beschrieben ist, wie man alle Teile des menschlichen Körpers aufbaut, repariert oder in Betrieb nimmt und erhält. Wie aber auch kaum noch einzelne Menschen jeden Schritt in der Herstellung oder auch Funktionsweise einer sehr komplexen Maschine übernehmen können, kann und soll auch die einzelne Zelle nicht alle Funktionen des menschlichen Körpers übernehmen. So muss mit diesen regulatorischen Abschnitten erreicht werden, dass bestimmte Zellen das Buch eben auf ganz bestimmten Seiten aufschlagen um abzulesen was genau dort steht: zum Beispiel eben die Anleitung zum Bau von Insulin. Die Zellen des Auges schlagen die Seite mit dem Insulinbauplan nicht auf, sondern ganz andere.

“POSTGENOMIK”

Wenn man sich diese vielfältigen Eigenschaften des Genoms vor Augen führt, dann kann man auch Verstehen, dass die Entschlüsselung des humanen Genoms mit so unheimlich großen medialem Interesse begleitet wurde.  Als dann im Februar 2001 gleichzeitig zwei unabhängige Varianten des humanen Genoms publiziert wurden (das Human Genome Project publiziert ein Genom in der Fachzeitschrift Nature [3] und Celera, eine Firma, die erst 1998 in das Rennen um das Humangenom einstieg, publizierte das Genom ihres Chefs, Craig Venter, in Science [4]) schien eine wissenschaftliche Revolution vollzogen. Doch schon bald erschien der Eindruck eine Art Blase, bestehend aus den enormen Erwartungen Beteiligter und Beobachter, würde zerplatzen. Die medizinsche Forschung im Zeitalter der “Postgenomik” (ein Begriff, der von den beiden Wissenschaftsautoren Staffan Müller-Wille und Hans-Jörg Rheinberger in einem Buch zud em Thema [5] geprägt wurde) schien sich nicht so wesentlich von der früheren medizinischen Forschung zu unterscheiden.

Der Begriff “Entschlüsselung” verspricht so einiges, aber was bedeutet er in diesem Zusammenhang wirklich? Er bedeutet, dass die gesamte Basenabfolge des Genoms (zunächst eines einzelnen Menschen) aufgedeckt wurde. Das ist eine Kombination von A, C, G und T (die Bezeichnung für die vier Basen/Nukleotide Adenin, Cytosin, Guanin und Thymin) auf 3,2 Milliarden Stellen. Man muss sich mal die Langweiligkeit des unmittelbaren Ergebnisses dieser Forschungsleistung vorstellen: ACGTGTACGGTGACGTTACGTCGATTCAGTC, nur hundert Millionen mal länger. Ohne also mehr über die Funktionen bestimmter Sequenzabschnitte und ihre Interaktionen mit den anderen Bestandteilen der Zelle unter bestimmten Bedingungen zu wissen, erscheint dieser genetische Code allerdings erst mal nicht viel Wert. Doch dieser Schein trügt.

Stellen Sie sich vor, ein bestimmtes Gen wäre sehr wichtig für eine bestimmte Funktion des menschlichen Körpers; so wichtig, dass diese Funktion nicht mehr richtig erfüllt werden kann, wenn das Gen etwa defekt ist. Ein Mensch, der diesen Defekt trägt hat also eine bestimmte Krankheit, die Mediziner vermutlich schon lange kennen, da sie immer wieder in der Bevölkerung vorkommt. Und nun nehmen wir an, wir wissen nichts über dieses Gen (tatsächlich gibt es noch eine Menge Gene, über die wir nicht viel wissen; auch gibt es eine Menge Krankheiten, deren genaue Ursachen wir ebenfalls nicht kennen). Bar jeder Ahnung vergleichen wir nun jede Menge Genome: einige hunderte oder tausende Genome von Menschen, die an dieser Krankheit leiden und mindestens genauso viele Genome von Menschen, die diese Krankheit nicht haben. Wenn wir davon ausgehen, dass sich individuelle Unterschiede, die nichts mit der Krankheit zu tun haben rausmitteln, dann entdecken wir vielleicht einen einzelnen oder einige wenige Sequenzvarianten, die hochsignifikant ungleich verteilt sind zwischen den Gruppen. Dieses Vorgehen wird im Forschungsfeld als genome-wide association study, oder kurz GWAS, bezeichnet. Wir haben also Varianten im Genom an ganz spezifischen Stellen entdeckt, die eben mit einer Krankheit assoziiert sind.

Dies kann uns einerseits wertvolle Hinweise geben, wenn wir die Ursachen der Erkrankung untersuchen wollen: diese Stellen sind vielleicht entweder innerhalb bestimmter Gene oder auch in oben beschriebenen regulatorischen Abschnitten, die die Aktivität bestimmter Gene steuern und können uns daher einen Link zu bestimmten Genen verraten. Diese Gene und ihre einwandfreie, wie auch gestörte Funktion näher zu untersuchen wird also sehr wahrscheinlich Aufschluss über die Krankheit liefern. Andererseits können uns diese Varianten auch dienen um zum Beispiel den Eintritt einer Erkrankung (mit einer gewissen Wahrscheinlichkeit) vorrauszusagen, wenn sich zB die Symptome einer Erkrankung erst ab einem gewissen Lebensalter zeigen, eine frühe Erkennung und Therapie aber sehr wertvoll sind. Ob und wieweit sich Menschen, zB mit einer bestimmten persönlichen oder familiären Krankengeschichte aber deswegen genotypisieren (der Unterschied zwischen Sequenzierungen und Genotypisierungen wird im Artikel zur Gentechnologie erläutert) lassen sollten, ist bestimmt nicht einfach zu beantworten. Denn natürlich haben Möglichkeiten dieser Art immer auch ihre Schattenseiten und man sollte sich als Gesellschaft sehr viel Zeit nehmen, um entsprechende Entwicklungen in ihrer Auswirkung sowohl auf einzelne Menschen, als auch auf die Gesellschaft selbst, zu verstehen, abzuwägen, zu bewerten und gegebenenfalls zu regulieren. Diese Aufgabe ist die vielleicht wichtigste, die im Zeitalter der “Postgenomik” nun zu anzugehen ist. Gerade wegen der Relevanz dieser Themen und der daraus resultierenden geforderten Akribie bei ihrer Bearbeitung kann und will dieser Blog auf derlei Thematiken nur verweisen.


[1] Speech of Bill Clinton, 2000, as recorded by The New York Times: https://partners.nytimes.com/library/national/science/062700sci-genome-text.html

[2] Tjio, J. H.; Levan, ALBERT (1956): THE CHROMOSOME NUMBER OF MAN. In Hereditas 42 (1-2), pp. 1–6. DOI: 10.1111/j.1601-5223.1956.tb03010.x.

[3] Lander, E. S.; Linton, L. M.; Birren, B.; Nusbaum, C.; Zody, M. C.; Baldwin, J. et al. (2001): Initial sequencing and analysis of the human genome. In: Nature 409 (6822), S. 860–921. DOI: 10.1038/35057062.

[4] Venter, J. C.; Adams, M. D.; Myers, E. W.; Li, P. W.; Mural, R. J.; Sutton, G. G. et al. (2001): The sequence of the human genome. In: Science (New York, N.Y.) 291 (5507), S. 1304–1351. DOI: 10.1126/science.1058040.